third generation lentiviruses  (ATCC)

Journal: Nature Communications

Article Title: Expression of ALS-PFN1 impairs vesicular degradation in iPSC-derived microglia

doi: 10.1038/s41467-024-46695-w

Figure Lengend Snippet: a Schematic representation of iMG differentiation protocol. Bone morphogenetic protein 4 (BMP-4), vascular endothelial growth factor (VEGF), and stem cell factor (SCF) are used for embryoid body differentiation. Macrophage colony-stimulating factor (M-CSF) and interleukin (IL)−3 are included during PMP generation. IL-34, M-CSF, and transforming growth factor beta (TGF-β) are added during terminal iMG differentiation. Created with BioRender.com. b , c WT and C71G +/ − iPSCs differentiated into iMGs. b Representative immunofluorescence images of P2RY12, TMEM119, and PFN1 for n = 3 independent differentiations. Scale bar: 100 µm. c Comparison of gene expression levels between iPSCs, PMPs, and iMGs of myeloid and microglia-enriched genes including GPR34 (* P = 0.0173, ** P = 0.0044), PROS1 (** P = 0.0040, *** P = 0.0002), P2RY12 (** P = 0.0030 for iPSC vs iMG, ** P = 0.0033 for PMP vs iMG), MERTK (** P = 0.0016 for iPSC vs iMG, ** P = 0.0049 for PMP vs iMG), and SPI-1 (* P = 0.0240) and the pluripotency marker SOX2 (*** P = 0.0003) d Three-dimensional principal component analysis (PCA) of iMGs from this study (green; WT n = 7, C71G +/ − n = 4, M114T +/ − n = 3, M114T +/+ n = 3, where n = an independent differentiation), primary human adult (yellow) and fetal microglia (navy blue) from Abud et al. iPSC-derived microglia-like cells (pink) and the intermediate hematopoietic progenitors cells (HPCs, dark orange) from Abud et al. iPSC-derived microglia-like cells (light orange) and the intermediate progenitors PMPs (light blue) from Brownjohn et al. and monocytes (dark blue) and iPSCs (gray) from Abud et al. . Variance of each principal component (PC) is indicated in parenthesis along the axes. e WT and C71G +/ − iMGs secrete elevated levels of IL-6 (** P = 0.0050), IL-10 (* P = 0.0156), CCL5 (** P = 0.0077) and TNF-α (* P = 0.0208) after 6 h or 24 h of 100 ng/mL LPS stimulation compared to untreated cells. Statistics were determined by two-way ANOVA and Šídák’s multiple comparisons test. No WT vs C71G +/ − comparisons were statistically significant. P -values are listed only for WT cells for simplicity; all other statistical comparisons are defined in Data S . Mean ± SEM for n = 3 independent differentiations are shown for all bar graphs, with each data point representing an individual differentiation. Source data are provided as a Source Data file.

Article Snippet: For PFN1 knockdown, third-generation lentiviruses carrying a CSCGW2 lentivector plasmid containing miRNA targeting PFN1 (GCAATAAGGGGTATGGGGTA) or a scramble sequence (TAATCGTATTTGTCAATCAT) under the U6 promoter were produced by VectorBuilder.

Techniques: Immunofluorescence, Comparison, Gene Expression, Marker, Derivative Assay

Journal: Nature Communications

Article Title: Expression of ALS-PFN1 impairs vesicular degradation in iPSC-derived microglia

doi: 10.1038/s41467-024-46695-w

Figure Lengend Snippet: a Volcano plot of proteins differentially expressed between C71G +/ − and WT iMGs identified by TMT proteomics. Log2 fold change in expression and significance (−log10 p -value) are displayed on the x- and y-axes, respectively. Differentially expressed proteins with a P -value < 0.00160 (blue dots) are considered significant after T-test followed by Benjamini-Hochberg correction (see Data ). b Western blot analysis of PFN1 levels in C71G +/ − , M114T +/ − , M114T +/+ iMGs compared to control WT iMGs. c , d Quantification of ( b ). For each independent differentiation, PFN1 protein levels were normalized first to GAPDH (loading control) and then to the respective WT control from the same differentiation. Statistics were determined using unpaired two-tailed t-test for c (** P = 0.0073, t = 5.035, df = 4) and ordinary one-way ANOVA with Dunnett’s multiple comparisons test for d (*** P = 0.0003, q = 8.232, df = 6, and **** P < 0.0001, q = 22.20, df = 6). e Bar graph of enriched terms across differentially expressed proteins generated by Enrichr using the Bioplanet 2019 library (see Data ). The significance of the term is defined on the x-axis. Terms of interest are emboldened. P -values were computed using a two-sided Fischer’s exact test. f – j Lipid droplets accumulate in mutant PFN1 iMGs as determined by BODIPY immunofluorescence analysis. f , g Representative immunofluorescence images of BODIPY staining in f PFN1 WT and C71G +/ − iMGs and g PFN1 WT, M114T +/ − and M114T +/+ iMGs. Cell boundaries are depicted with white dashed lines. Scale bar = 25 µm. h , i Quantification of the area of BODIPY fluorescence signal representing lipid droplets (LD) was normalized to WT iMGs within each independent differentiation for f (unpaired two-tailed t -test, * P = 0.0137, t = 4.201, df = 4) and g (ordinary one-way ANOVA and Dunnett’s multiple comparisons test, ns P = 0.3647, q = 1.338, df = 6 for WT vs M114T +/ − and ** P = 0.0020, q = 5.840, df = 6 for WT vs M114T +/+ ). j Representative immunofluorescence images (one Z-plane acquired by focusing on prominent lipid droplets) showing PFN1 (gray) surrounding lipid droplets (BODIPY in green) in C71G +/ − iMGs from n = 3 independent differentiations. Scale bar = 10 µm. All data include n = 3 independent differentiations. Bar graphs show mean ± SEM with individual data points representing independent differentiations. Source data are provided as a Source Data file.

Article Snippet: For PFN1 knockdown, third-generation lentiviruses carrying a CSCGW2 lentivector plasmid containing miRNA targeting PFN1 (GCAATAAGGGGTATGGGGTA) or a scramble sequence (TAATCGTATTTGTCAATCAT) under the U6 promoter were produced by VectorBuilder.

Techniques: Expressing, Western Blot, Control, Two Tailed Test, Generated, Mutagenesis, Immunofluorescence, Staining, Fluorescence

Journal: Nature Communications

Article Title: Expression of ALS-PFN1 impairs vesicular degradation in iPSC-derived microglia

doi: 10.1038/s41467-024-46695-w

Figure Lengend Snippet: a Volcano plot of differentially expressed genes between ALS-PFN1 iMGs ( n = 4 for C71G +/ − iMGs and n = 3 for M114T +/ − iMGs) relative to WT iMGs ( n = 7), where n refers to an independent differentiation; see Data . Differentially expressed genes ( P -adjusted value < 0.05) are highlighted in blue. b , c Relative mRNA levels of TBC1D15 normalized to the average of the respective WT iMGs. b * P = 0.0452, t = 2.875, df = 4 for n = 3 independent differentiations; c WT n = 2, M114T +/ − and M114T +/+ n = 3 independent differentiations. d TBC1D15 protein expression determined by Western blot analysis. e Quantification of ( d ). TBC1D15 levels were normalized to GAPDH and then to the levels of the respective WT line from the same differentiation (* P = 0.0197, t = 3.763, df = 4) for n = 3 independent differentiations. f , g Colocalization analysis of TBC1D15 and TOMM20 in WT and C71G +/ − iMGs. f Representative immunofluorescence images of TBC1D15 (green), TOMM20 (red), and merged images including DAPI (blue) showing regions of overlayed TBC1D15:TOMM20 signal in yellow. Scale bar = 25 µm. g Pearson’s correlation coefficient of TBC1D15 and TOMM20 signal ( ***P = 0.0004, t = 5.714, df = 8) for n = 5 independent differentiations. All bar graphs show mean ± SEM, where each data point represents an independent differentiation. Statistics were determined using unpaired two-tailed t -test for WT vs C71G +/ − iMGs comparisons or ordinary one-way ANOVA with Dunnett’s multiple comparisons test for WT vs M114T +/ − and M114T +/+ comparisons. Source data are provided as a Source Data file.

Article Snippet: For PFN1 knockdown, third-generation lentiviruses carrying a CSCGW2 lentivector plasmid containing miRNA targeting PFN1 (GCAATAAGGGGTATGGGGTA) or a scramble sequence (TAATCGTATTTGTCAATCAT) under the U6 promoter were produced by VectorBuilder.

Techniques: Expressing, Western Blot, Immunofluorescence, Two Tailed Test

Journal: Nature Communications

Article Title: Expression of ALS-PFN1 impairs vesicular degradation in iPSC-derived microglia

doi: 10.1038/s41467-024-46695-w

Figure Lengend Snippet: Analysis of PFN1 C71G +/ − ( n = 4) and WT ( n = 5) mouse brains injected with dead neurons co-labeled with the constitutively fluorescent dye Alexa Fluor 546 (AF-neurons) and the pH-sensitive dye Cypher5E (Cy5E-neurons) 72 h post-injection. a Representative immunofluorescence images at the injection site in the mouse motor cortex of the myeloid marker IBA1(gray), the residual dead neurons (AF-neurons in green), and the dead neurons localized in acidic compartments (Cy5E-neurons in red) as well as the overlaid image of AF-neurons and Cy5E-neurons (merged in yellow). Scale bar: 200 µm. b Representative confocal images of IBA1-positive (IBA1 + ) cells colocalizing with Cy5E-neuron signal from a PFN1 WT (top) and PFN1 C71G +/ − (bottom) mouse brain (scale bar: 25 µm) including higher magnification insets (scale bar: 10 µm). c Quantification of the total area of residual AF-neuron signal (ns P = 0.7288, t = 0.3610, df = 7). d The fraction of Cy5E-neuron (total area) signal that overlays with the AF-neuron (total area) signal from c ( *P = 0.0499, t = 2.366, df = 7). e Representative IBA1 (gray) immunofluorescence images at the injection site for WT PFN1 and PFN1 C71G +/ − mice. Three concentric rings (yellow) around the site of injection (center ring) are shown for analysis in ( f and g ). Scale bar: 100 µm. f Quantification of total IBA1 signal intensity in the three rings surrounding the injection site labeled in ( e ) normalized to the number of IBA + cells (** P = 0.0058, t = 3.909, df = 7 for ring 1; * P = 0.0264, t = 2.804, df = 7 for ring 2; * P = 0.0374, t = 2.563, df = 7 for ring 3). g Quantification of the number of IBA1 + cells in each ring indicated in ( e ) (ns P = 0.4752, t = 0.7545, df = 7 for ring 1; ns P = 0.9264, t = 0.09573, df = 7 for ring 2; * P = 0.0255, t = 2.827, df = 7). Unpaired two-tailed t -test was used for all statistical comparisons. Graphs in this figure show mean ± SEM. Data points represent individual animals. Males are plotted open symbols and females with closed symbols. Source data are provided as a Source Data file.

Article Snippet: For PFN1 knockdown, third-generation lentiviruses carrying a CSCGW2 lentivector plasmid containing miRNA targeting PFN1 (GCAATAAGGGGTATGGGGTA) or a scramble sequence (TAATCGTATTTGTCAATCAT) under the U6 promoter were produced by VectorBuilder.

Techniques: Injection, Labeling, Immunofluorescence, Marker, Two Tailed Test

Journal: Nature Communications

Article Title: Expression of ALS-PFN1 impairs vesicular degradation in iPSC-derived microglia

doi: 10.1038/s41467-024-46695-w

Figure Lengend Snippet: a , b De-quenched DQ-BSA fluorescence intensity measured over 4 h by live-cell imaging of PFN1 WT and C71G +/ − iMGs ( a ns P = 0.5740, F (1, 4) = 0.3737) and of PFN1 WT and M114T +/ − iMGs ( b ns P = 0.0717, F (1, 4) = 5.921). Data were normalized to total cell number. Statistics were obtained by two-way ANOVA for n = 3 independent differentiations. c The fluorescence intensity of Lysosensor DND-189 was quantified for WT ( n = 6 for two different lines) and ALS-PFN1 (C71G +/ − n = 3, solid squares and M114T +/ − n = 3, open squares) iMGs at baseline or pre-treated with 200 nM Bafilomycin A (WT n = 5 from two different lines and ALS-PFN1 from C71G +/ − n = 3, solid squares and M114T +/ − n = 2, open squares, BafA; *** P = 0.0006 for WT untreated vs BafA or P = 0.0002 for ALS-PFN1 untreated vs BafA; ns P = 0.9840 for untreated WT vs ALS-PFN1 or P = 0.9938 for BafA WT vs ALS-PFN1). Data was normalized to WT iMGs for each independent differentiation. Statistics were determined by one-way ANOVA (F 0.1243 = (3, 18)) and Tukey’s multiple comparisons test. d Western blot analysis of LAMP1 and the mature form of Cathepsin D (mCTSD) from WT and C71G +/ − ( n = 3 independent differentiations) with GAPDH as a loading control. e , f Quantification of ( d ) for LAMP1 ( e ns P = 0.9703, t = 0.03967, df = 4) and mCTSD ( f ns P = 0.4999, t = 0.7409, df = 4). Levels of the target proteins were first normalized to GAPDH and then to the WT control lane corresponding to the same differentiation. Statistics were determined by unpaired two-tailed t -test. g Representative immunofluorescence images of LAMP1 in PFN1 WT ( n = 7) and ALS-PFN1 (C71G +/ − n = 4 and M114T +/ − n = 3) iMGs. White asterisks indicate cells with perinuclear LAMP1 signal. Scale bar = 50 µm. h Percentage of iMGs showing LAMP1 perinuclear localization for WT ( n = 5 for two iPSC lines) and ALS-PFN1 (C71G +/ − n = 2, solid squares and M114T +/ − n = 3, open squares) iMGs. Statistics were determined by unpaired two-tailed t -test (*** P = 0.0004, t = 5.768, df = 8). All graphs show mean ± SEM and individual data points in the bar graphs represent independent differentiations. Source data are provided as a Source Data file.

Article Snippet: For PFN1 knockdown, third-generation lentiviruses carrying a CSCGW2 lentivector plasmid containing miRNA targeting PFN1 (GCAATAAGGGGTATGGGGTA) or a scramble sequence (TAATCGTATTTGTCAATCAT) under the U6 promoter were produced by VectorBuilder.

Techniques: Fluorescence, Live Cell Imaging, Western Blot, Control, Two Tailed Test, Immunofluorescence

Journal: Nature Communications

Article Title: Expression of ALS-PFN1 impairs vesicular degradation in iPSC-derived microglia

doi: 10.1038/s41467-024-46695-w

Figure Lengend Snippet: a – c LC3I and LC3II expression in PFN1 iMGs by Western blot analysis from n = 5 independent differentiations. a Representative Western blot of LC3I, LC3II, and GAPDH as loading control. b , c Quantification of LC3I and LC3II in ( a ). b LC3II/LC3I ratio normalized to WT iMGs in each differentiation (ns P = 0.6978, t = 0.403, df = 8). c Total LC3 levels (LC3I + LC3II) normalized to GAPDH and reported as relative to WT iMGs (ns P = 0.7810, t = 0.288, df = 8). d – e p62 protein levels in PFN1 iMGs after bafilomycin A or rapamycin treatment compared to untreated cells. d Representative Western blots of p62 for PFN1 iMGs under untreated conditions or 0.1 µM rapamycin ( n = 4 independent differentiations) and under untreated conditions or 100 nM bafilomycin A ( n = 5 independent differentiations). e Quantification of ( d ), with p62 bands normalized to GAPDH and all data reported as relative to untreated WT iMGs. (Untreated WT vs C71G +/ − * P = 0.0430, t = 2.594, df = 30; rapamycin WT vs C71G +/ − ns P = 0.8917, t = 0.646, df = 30; bafilomycin A WT vs C71G +/ − ns P = 0.3200, t = 1.597, df = 30). Statistics were determined by two-way ANOVA and Šídák’s multiple comparisons test. f Representative immunofluorescence images of LC3 (green) and p62 (red) puncta with DAPI (blue) in PFN1 iMGs. Scale bar: 25 µm and 1 µm (inset). g , h Quantification of puncta per cell for LC3 ( g ns P = 0.1689, t = 1.379, df = 289) and p62 ( h *** P = 0.0002, t = 3.748, df = 289) from n = 147 WT and 144 C71G +/ − cells across 4 independent differentiations. i , j Quantification of the puncta size for LC3 ( i ns P = 0.1828, t = 1.332, df = 2434) and p62 ( j **** P < 0.0001, t = 4.509, df = 3660) from n = 960 WT and 1476 C71G +/ − puncta from the same cells as ( g , h ). k Pearson’s coefficient of the colocalization between LC3 and p62 puncta (** P = 0.0040, t = 2.898, df = 285) from n = 144 WT and 143 C71G +/ − cells across 4 independent differentiations. All bar graphs show mean ± SEM and data points represent individual differentiations ( b , c , e ), cells ( g , h , k ), or puncta ( i , j ). Statistics for bar graphs other than e were determined by unpaired two-tailed t -test. Source data are provided as a Source Data file.

Article Snippet: For PFN1 knockdown, third-generation lentiviruses carrying a CSCGW2 lentivector plasmid containing miRNA targeting PFN1 (GCAATAAGGGGTATGGGGTA) or a scramble sequence (TAATCGTATTTGTCAATCAT) under the U6 promoter were produced by VectorBuilder.

Techniques: Expressing, Western Blot, Control, Immunofluorescence, Two Tailed Test

Journal: Nature Communications

Article Title: Expression of ALS-PFN1 impairs vesicular degradation in iPSC-derived microglia

doi: 10.1038/s41467-024-46695-w

Figure Lengend Snippet: Live-cell phagocytosis assays using pHrodo-labeled mouse synaptosomes as substrate for WT ( n = 5 for two different lines), ALS-PFN1 (C71G +/ − n = 2 and M114T +/ − n = 3), and M114T +/+ ( n = 3) iMGs pre-treated with 0.1 µM rapamycin. a Quantification of the phagocytosis index (see “Methods” section). Two-way ANOVA and Tukey’s multiple comparisons test was used for statistical analysis. Comparisons relative to WT iMGs with DMSO are shown (**** P < 0.0001, ** P = 0.0015, ns P = 0.4638 for ALS-PFN1 with 0.1 µM Rapamycin, and ns P > 0.9999 for M114T +/+ with 0.1 µM Rapamycin). b Area under the curve ( AUC) determined from ( a ). Within the ALS-PFN1 group, solid squares are for C71G +/- n = 2, open squares are for M114T +/- n = 3. Statistics were determined by two-way ANOVA and Šídák’s multiple comparisons test for: the DMSO condition (* P = 0.0326 for WT vs ALS- P FN1 and *** P = 0.0006 for WT vs M114T +/+ ), the DMSO vs 0.1 µM Rapamycin condition per genotype ( P = 0.9152 for WT, ** P = 0.0081 for ALS-PFN1, and ** P = 0.0038 for M114T +/+ ) and the 0.1 µM Rapamycin condition ( P = 0.9993 for WT vs ALS- PFN1, P = 0.8904 for WT vs M114T +/+ ). All graphs show mean ± SEM and individual data points in the bar graphs represent independent differentiations. Source data are provided as a Source Data file.

Article Snippet: For PFN1 knockdown, third-generation lentiviruses carrying a CSCGW2 lentivector plasmid containing miRNA targeting PFN1 (GCAATAAGGGGTATGGGGTA) or a scramble sequence (TAATCGTATTTGTCAATCAT) under the U6 promoter were produced by VectorBuilder.

Techniques: Labeling

Journal: Nature Communications

Article Title: Expression of ALS-PFN1 impairs vesicular degradation in iPSC-derived microglia

doi: 10.1038/s41467-024-46695-w

Figure Lengend Snippet: a , b Differential scanning fluorimetry (DSF) with PFN1 WT and M114T proteins in the presence of PI3P. a Thermal denaturation profiles of PFN1 proteins incubated with PI3P measured by SYPRO Orange fluorescence as a function of increasing temperature. An average of two technical replicates is shown and is representative of n = 4–9 independent experiments. The curves were fit to the Boltzmann’s sigmoidal function to determine the apparent melting temperature (T m ). b ΔT m reports the difference between the T m at the indicated PI3P concentration and the protein without PI3P. Statistics were determined using two-way ANOVA F (1, 28) = 7.115 and Šídák’s multiple comparisons test (** P = 0.0038 for 200 µM and ns P = 0.735 for 50 µM or 0.9326 for 20 µM) for WT n = 9 and M114T n = 8 independent experiments using different PI3P concentrations as described in the Source Data file. Bar graphs show mean ± SEM with each data point representing an independent experiment. c Summary of T m and ΔT m obtained from ( b ) and the dissociation constants from the NMR studies ( d – g ) for PFN1 WT and M114T with PI3P. d – g Titration of PFN1 with PI3P using NMR. d Overlay of N- 1 H HSQC spectra of PFN1 free (black) and bound to PI3P (red) for PFN1 WT. e the same as ( d ) except for PFN1 M114T in the free state (black) and bound to PI3P (blue). d , e Insets show the overlay of spectra collected during the titration of PI3P for select residues. f , g Chemical shift differences between spectra of PFN1 alone and the PI3P-PFN1 complex are mapped onto the structure of PFN1 in the ternary complex with actin (light blue) and PLP (yellow); pdb ID 2PAV for PFN1 WT ( f ) and PFN1 M114T PFN1 ( g ). Residues are colored according to the chemical shift perturbation measured upon PI3P binding as indicated by the scale bar, with white and red corresponding to 0–0.1 ppm, respectively. PFN1 residues presenting chemical shift perturbations ≥0.1 ppm are shown in red. Additional information is in Supplementary Fig. . Source data are provided as a Source Data file.

Article Snippet: For PFN1 knockdown, third-generation lentiviruses carrying a CSCGW2 lentivector plasmid containing miRNA targeting PFN1 (GCAATAAGGGGTATGGGGTA) or a scramble sequence (TAATCGTATTTGTCAATCAT) under the U6 promoter were produced by VectorBuilder.

Techniques: Incubation, Fluorescence, Concentration Assay, Titration, Binding Assay

Journal: Nature Communications

Article Title: Expression of ALS-PFN1 impairs vesicular degradation in iPSC-derived microglia

doi: 10.1038/s41467-024-46695-w

Figure Lengend Snippet: Mutant iMGs are capable of engulfing substrate (phagocytosis pathway) and forming autophagosomes (autophagy pathway). However, mutant PFN1 expression impairs degradative processing through these pathways, accounting for the accumulation of lipid droplets, upregulation of TBC1D15 at mitochondria, and delayed degradation of phagocytosed material. Vesicles within these pathways contain PI3P, a signaling lipid that is central and critical for efficient vesicular maturation and degradation. Mutant and misfolded PFN1 exhibits enhanced binding to PI3P, raising the possibility that mutant PFN1 interferes with endo-lysosomal processing through a gain-of-toxic function involving PI3P signaling. Created with BioRender.com.

Article Snippet: For PFN1 knockdown, third-generation lentiviruses carrying a CSCGW2 lentivector plasmid containing miRNA targeting PFN1 (GCAATAAGGGGTATGGGGTA) or a scramble sequence (TAATCGTATTTGTCAATCAT) under the U6 promoter were produced by VectorBuilder.

Techniques: Mutagenesis, Expressing, Binding Assay

Journal: ACS Synthetic Biology

Article Title: Engineering an Autonucleolytic Mammalian Suspension Host Cell Line to Reduce DNA Impurity Levels in Serum-Free Lentiviral Process Streams

doi: 10.1021/acssynbio.3c00682

Figure Lengend Snippet: During lentivirus production, NuPro-2S cells give rise to medium-resident nuclease activity that reduces DNA impurity levels in situ . (A) Before and after the Figure C Benzonase addition, 10 mL samples of HEK293TS cells were centrifuged at 500 rcf for 5 min, and the supernatant was removed and retained as “Clarified Media”. Uncentrifuged samples were also taken and retained as “Whole Culture”. Equivalent NuPro2S samples were also taken. All samples were then incubated at 37 °C for a 1 h hold step. This diagram illustrates the anticipated presence of nuclease activity (red symbols) arising from NuPro-2S and the presence of lentivirus (green symbols) produced from both cell lines and confirmed in Figure . (B) “Clarified Media” samples (8 μL) were incubated with 2 μL of a 500 ng/μL 1 kb DNA ladder solution for 1 h prior to agarose gel electrophoresis. Samples were either pre- or posthold, as indicated, and taken from cultures of the indicated cell lines. Cultures had either had no additions or addition of tetracycline or Benzonase as detailed in Figure . (C) 40 μL samples, either pre- or posthold, from the indicated cultures were analyzed directly by agarose gel electrophoresis. (D) 100 μL serially diluted samples posthold from the indicated cultures were analyzed using the PicoGreen reagent, and the DNA was content plotted. Error bars represent the standard deviation of means arising from samples from n = 2 lentiviral production runs, each of which was used for n = 3 Pico Green-based determinations. Significance was determined by the unpaired Student’s t test. DNA concentration differences between unsupplemented HEK293TS and Benzonase-supplemented HEK293TS ( p = 0.0921), and NuPro-2S ( p < 0.0001) were significant (asterisks), while differences between Benzonase-supplemented HEK293TS and NuPro-2S were not (ns). All gel images are representative of duplicate gels used for analysis of duplicate samples.

Article Snippet: The following third-generation lentivirus plasmids were used: pLJM1-eGFP (Addgene plasmid no. 19319) encoding the eGFP reporter payload genome, pMDLg/pRRE (Addgene plasmid no. 12251) encoding gagpol proteins, pRSV-Rev (Addgene plasmid no. 12253) encoding rev, and pMD2.G (Addgene plasmid no. 12259) encoding the VSV-G envelope protein.

Techniques: Activity Assay, In Situ, Incubation, Produced, Agarose Gel Electrophoresis, Standard Deviation, Concentration Assay